View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_high_13 (Length: 401)
Name: NF0961_high_13
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 316 - 373
Target Start/End: Complemental strand, 1141467 - 1141410
Alignment:
| Q |
316 |
aaattattaatatgtgcatcaatcaaatcacactaaatagatatttttgacaatattt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1141467 |
aaattattaatatgtgcatcaatcaaatcacactaaatagatatttttgacaatattt |
1141410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University