View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_high_17 (Length: 382)
Name: NF0961_high_17
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0961_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 181 - 259
Target Start/End: Original strand, 25525140 - 25525218
Alignment:
Q |
181 |
gatttatcatagggagcagtatacatggcttacatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg |
259 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25525140 |
gatttatcatagggagcagtatacatggcttccatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg |
25525218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University