View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_high_26 (Length: 321)
Name: NF0961_high_26
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 13 - 310
Target Start/End: Complemental strand, 47876112 - 47875815
Alignment:
| Q |
13 |
acttccttttggcggtaagcatggcgatatgaacagtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgcttc |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47876112 |
acttccttttggcggtaagcatagcgatatgaacggtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgcttg |
47876013 |
T |
 |
| Q |
113 |
nnnnnnnnttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacagctactccttac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47876012 |
aaaaaaatttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacaactactccttac |
47875913 |
T |
 |
| Q |
213 |
agaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875912 |
agaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata |
47875815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University