View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_high_28 (Length: 264)
Name: NF0961_high_28
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_high_28 |
 | |
|
| [»] scaffold0439 (3 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 20039652 - 20039774
Alignment:
| Q |
1 |
ccctcttcgttaaccctatctttcggagaaaaggacacgctactcgacttgtaaccatggctgaaatggacttggaaaaggttttgtatgtttggattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20039652 |
ccctcttcgttaaccctatctttcggagaaaaggacacgctactcgacttgtgaccatggctcaaatggacttggaaaaggttttgtatgtttggattag |
20039751 |
T |
|
| Q |
101 |
tttgttaagttagaagtctgtta |
123 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
20039752 |
tttgttaagttagaagtgtgtta |
20039774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 167 - 257
Target Start/End: Original strand, 20039770 - 20039861
Alignment:
| Q |
167 |
tgttagattgtgtataactaacaagtgtgtcttctttta-atggttactttacctgtgtttgtagcaaggtgctgcttacgtctctgtgctc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
20039770 |
tgttagattgtgtataactaacaagtgtgtcttctttaatatggttactttacctgtgtttgtagcaaggtgctgcttacatctcagtgctc |
20039861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0439 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: scaffold0439
Description:
Target: scaffold0439; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 5311 - 5228
Alignment:
| Q |
1 |
ccctcttcgttaaccctatctttcggagaaaaggacacgctactcgacttgtaaccatggctgaaatggacttggaaaaggttt |
84 |
Q |
| |
|
|||||||| |||||| |||||||| ||||||||||||||||||||||||||| |||| || |||||||||||||| ||||||| |
|
|
| T |
5311 |
ccctcttcattaaccgtatctttcagagaaaaggacacgctactcgacttgtgaccaatgccgaaatggacttggacaaggttt |
5228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0439; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 207
Target Start/End: Complemental strand, 5192 - 5082
Alignment:
| Q |
100 |
gtttgttaagttagaagtctgttattgatattgttaagtttgttaaaatcatatatgtcaggtgtta-----tgttagattgtgtataactaacaagtgt |
194 |
Q |
| |
|
||||||||||||| | ||||||||| | ||||||| |||| ||||||||||||||||| | ||||| ||||||||| |||||| |||||| ||| |
|
|
| T |
5192 |
gtttgttaagttatatgtctgttatagctattgtt-agttagttaaaatcatatatgtta-atgttaggaggagttagattgagtataattaacaattgt |
5095 |
T |
|
| Q |
195 |
gtcttcttttaat |
207 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5094 |
gtcttcttttaat |
5082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0439; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 219 - 250
Target Start/End: Complemental strand, 5034 - 5003
Alignment:
| Q |
219 |
ctgtgtttgtagcaaggtgctgcttacgtctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5034 |
ctgtgtttgtagcaaggtgctgcttacgtctc |
5003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University