View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_high_36 (Length: 206)

Name: NF0961_high_36
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_high_36
NF0961_high_36
[»] chr8 (1 HSPs)
chr8 (21-166)||(29809033-29809178)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 21 - 166
Target Start/End: Complemental strand, 29809178 - 29809033
Alignment:
21 tattcttttgcaagacactactatcctttatttgccctatttaagacaagctagttgcatgtgtattt-cacttcaaattctacactatagttctcnnnn 119  Q
    ||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||        
29809178 tattcttttgcaagacactactaccctttatt-gccctatttaaggcaagctagttgcatgtgtattttcacttaaaattctacactatagttctctttt 29809080  T
120 nnncttacaagttatcatggctcgttcagttcctttggttttcacca 166  Q
       |||||||||||||||||||||||||||||||||||||| |||||    
29809079 tttcttacaagttatcatggctcgttcagttcctttggtttccacca 29809033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University