View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_high_36 (Length: 206)
Name: NF0961_high_36
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0961_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 21 - 166
Target Start/End: Complemental strand, 29809178 - 29809033
Alignment:
Q |
21 |
tattcttttgcaagacactactatcctttatttgccctatttaagacaagctagttgcatgtgtattt-cacttcaaattctacactatagttctcnnnn |
119 |
Q |
|
|
||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
29809178 |
tattcttttgcaagacactactaccctttatt-gccctatttaaggcaagctagttgcatgtgtattttcacttaaaattctacactatagttctctttt |
29809080 |
T |
 |
Q |
120 |
nnncttacaagttatcatggctcgttcagttcctttggttttcacca |
166 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
29809079 |
tttcttacaagttatcatggctcgttcagttcctttggtttccacca |
29809033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University