View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_low_12 (Length: 442)
Name: NF0961_low_12
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 147 - 306
Target Start/End: Complemental strand, 45363087 - 45362928
Alignment:
| Q |
147 |
taaacaccattgagtttgattgaatactaaccaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacag |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
45363087 |
taaacaccattgagttttattgaatactaaccaagactgaacatggccatgccaagccctgcatccgacaatatggaaatagactttgctatgataacag |
45362988 |
T |
 |
| Q |
247 |
gcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362987 |
gcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaat |
45362928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 86 - 116
Target Start/End: Complemental strand, 45363267 - 45363237
Alignment:
| Q |
86 |
atgaacagaatcataaaggaaaaggagcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45363267 |
atgaacagaatcataaaggaaaaggagcaaa |
45363237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 176 - 258
Target Start/End: Complemental strand, 25040782 - 25040700
Alignment:
| Q |
176 |
accaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacaggcatttcaatat |
258 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||| ||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
25040782 |
accaagactgaacatagccatgccaagtcctgcatctgacagaatggaaatagactttgctataatggcaggcatttcaatat |
25040700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University