View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_20 (Length: 382)

Name: NF0961_low_20
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_20
NF0961_low_20
[»] chr3 (1 HSPs)
chr3 (181-259)||(25525140-25525218)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 181 - 259
Target Start/End: Original strand, 25525140 - 25525218
Alignment:
181 gatttatcatagggagcagtatacatggcttacatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg 259  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
25525140 gatttatcatagggagcagtatacatggcttccatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg 25525218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University