View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_low_27 (Length: 324)
Name: NF0961_low_27
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0961_low_27 |
 |  |
|
[»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 94 - 324
Target Start/End: Complemental strand, 34180514 - 34180284
Alignment:
Q |
94 |
agatatggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggctaagataagggataggataggtgtagaggaggaggg |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34180514 |
agatatggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggctaagataagggataggataggtgtagaggaggaggg |
34180415 |
T |
 |
Q |
194 |
ttggttttcggagagagtgtcgagaaaggtgggggatgtgacatttactttattttggtatgatcggtggttaaggaaaggttcctctttgtcagcgttt |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34180414 |
ttggttttcggagagagtgtcgagaaaggtgggggatgtgacatttactatattttggtatgatcggtggttaaggaaaggttcctctttgtcagcgttt |
34180315 |
T |
 |
Q |
294 |
tagtcgattgttcaatctaaaggagaacaag |
324 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
34180314 |
tagtcgattgttcaatctaaaggagaacaag |
34180284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 100 - 159
Target Start/End: Original strand, 900417 - 900476
Alignment:
Q |
100 |
ggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggcta |
159 |
Q |
|
|
|||||||||||| | ||||||||| ||||| | ||||||||| |||||||||| |||||| |
|
|
T |
900417 |
ggtgaggaggcagggaggttgggggccagagttgttcttattagtggagggagttggcta |
900476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 104 - 292
Target Start/End: Original strand, 25388431 - 25388618
Alignment:
Q |
104 |
aggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggctaagataagggataggataggtgtagaggaggagggttggttttcg |
203 |
Q |
|
|
|||||||| | ||||||||| ||||| ||||||||||||||||||||||||||||| ||| | ||| | | |||| || | ||| ||||||||| | |
|
|
T |
25388431 |
aggaggcagggaggttgggggccagagtggttcttattggtggagggaggtggctaggattaaggaccgcgttggtgaggatggggaaggttggtttaca |
25388530 |
T |
 |
Q |
204 |
gagagagtgtcgagaaaggtgggggatgtgacatttactttattttggtatgatcggtggttaaggaaaggttcctctttgtcagcgtt |
292 |
Q |
|
|
||||| |||||| |||||||||| |||| | | |||||| |||||||||||| ||||||| |||| |||||||||||||| |||| |
|
|
T |
25388531 |
gagagggtgtcgcgaaaggtgggtgatggggctgatactttcttttggtatgataggtggtt-aggaggtgttcctctttgtcaacgtt |
25388618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 131 - 266
Target Start/End: Complemental strand, 20349510 - 20349375
Alignment:
Q |
131 |
tggttcttattggtggagggaggtggctaagataagggataggataggtgtagaggaggagggttggttttcggagagagtgtcgagaaaggtgggggat |
230 |
Q |
|
|
||||||| ||||||||||||| | || ||||| |||||| ||||||| | ||||||||||||||| | ||||| ||||||| ||||||||||||| |
|
|
T |
20349510 |
tggttctctttggtggagggagatagcgaagattagggatgggataggcgattctgaggagggttggtttgcagagagggtgtcgaaaaaggtgggggat |
20349411 |
T |
 |
Q |
231 |
gtgacatttactttattttggtatgatcggtggtta |
266 |
Q |
|
|
|| || |||||| |||||||||||| |||||||| |
|
|
T |
20349410 |
gtaactagtactttcttttggtatgataggtggtta |
20349375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 12308675 - 12308732
Alignment:
Q |
97 |
tatggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggt |
154 |
Q |
|
|
||||||||||||||||| ||||||||| || || |||||||||||||||||||||||| |
|
|
T |
12308675 |
tatggtgaggaggcatggaggttgggggccggagtggttcttattggtggagggaggt |
12308732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 23054525 - 23054586
Alignment:
Q |
98 |
atggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggcta |
159 |
Q |
|
|
|||||||||||||| | ||||||||| || || || ||||||| ||||||| |||||||||| |
|
|
T |
23054525 |
atggtgaggaggcagggaggttgggggccggagtgtttcttataggtggagagaggtggcta |
23054586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 133 - 231
Target Start/End: Original strand, 15862273 - 15862371
Alignment:
Q |
133 |
gttcttattggtggagggaggtggctaagataagggataggataggtgtagaggaggagggttggttttcggagagagtgtcgagaaaggtgggggatg |
231 |
Q |
|
|
|||| |||||||||||||||||||||| ||| || ||| | |||| | |||| ||| ||||||| || ||||| ||||||||||||||||| |||| |
|
|
T |
15862273 |
gttcgtattggtggagggaggtggctaggattagagatggtgtaggagaggagggtgagagttggttctcagagagggtgtcgagaaaggtgggagatg |
15862371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 23923473 - 23923400
Alignment:
Q |
97 |
tatggtgaggaggcatgaaggttggggcccagaatggttcttattggtggagggaggtggctaagataagggat |
170 |
Q |
|
|
||||||||||||||| ||||||||| | || |||||||| ||||||| |||||||| ||||||| |||||| |
|
|
T |
23923473 |
tatggtgaggaggcagagaggttgggggtctgagtggttctttttggtggcgggaggtgactaagatcagggat |
23923400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University