View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_low_30 (Length: 315)
Name: NF0961_low_30
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 114 - 192
Target Start/End: Original strand, 25525140 - 25525218
Alignment:
| Q |
114 |
gatttatcatagggagcagtatacatggcttacatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25525140 |
gatttatcatagggagcagtatacatggcttccatcgacttcccaaatttggaatttttgaaggcttctgcaatctctg |
25525218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University