View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_low_32 (Length: 295)
Name: NF0961_low_32
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 228
Target Start/End: Original strand, 13975328 - 13975526
Alignment:
| Q |
30 |
atgaaggcgaatccaatgaaaaccaggctgaaccaaatggaatgaatacttagcttcttgaatgaaaattctagcagttgaatatataggtgaaggaaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975328 |
atgaaggcgaatccaatgaaaaccaggctgaaccaaatggaatgaatacttagcttcttgaatgaaaattctagcagttgaatatataggtgaaggaaca |
13975427 |
T |
|
| Q |
130 |
tcagcatcagttgctgaaactttgtaatcatccttagcttgtaaaaatgaatttgcttgtggatctgatttgaattgtctaccatcaggtaaagtaact |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975428 |
tcagcatcagttgctgaaactttgtaatcatccttagcttgtaaaaatgaatttgcttgtggatctgatttgaattgtctaccatcaggtaaagtaact |
13975526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University