View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0961_low_40 (Length: 237)
Name: NF0961_low_40
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0961_low_40 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 33828285 - 33828064
Alignment:
| Q |
16 |
tttttcattaagatatacataagtttttaatttctttttaaccataaacctgtttaagttatatcaccaacttaatcaaataattcctctcatattaact |
115 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828285 |
tttttcgttaagacatacataagtttttaatttctttttaaccataaacctgtttaagttatatcaccaacttaatcaaataattcctctcatattaact |
33828186 |
T |
 |
| Q |
116 |
ataattgttttaataacttttcagccattaccggatgatttcaaaactacatcattactgacttcttgcaccgtgtaaaatttatcattgcagcattaaa |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828185 |
ataattgttttaataatttttcagccattaccggatgatttcaaaactacatcattactgacttcttgcaccgtgtaaaatttatcattgcagcattaaa |
33828086 |
T |
 |
| Q |
216 |
atctcacttccaattccaaaat |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33828085 |
atctcacttccaattccaaaat |
33828064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University