View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_46 (Length: 221)

Name: NF0961_low_46
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_46
NF0961_low_46
[»] chr4 (1 HSPs)
chr4 (1-124)||(39782889-39783012)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 39783012 - 39782889
Alignment:
1 cgacgagactgaaattgagctgacattaggcccgtcgagttataaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39783012 cgacgagactgaaattgagctgacattaggcccgtcgagttataaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtct 39782913  T
101 tcatcttcaactggatcaagtgat 124  Q
    ||||||||||||||||||||||||    
39782912 tcatcttcaactggatcaagtgat 39782889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University