View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_18 (Length: 454)
Name: NF0962_high_18
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 30 - 313
Target Start/End: Complemental strand, 10494754 - 10494472
Alignment:
Q |
30 |
gtttgttgtacatgttcagtttgatcaatggttggtgttgagcattcaaaatcatgctttggtctctcgttgtcttgtaacttgtttggttatagtggag |
129 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10494754 |
gtttgttgtgcatgttcagtttgatcaatggttggtgttgagcattcaaaatcatgctttggtctctcgttgtcttgtaacttgtttggttatagtggag |
10494655 |
T |
 |
Q |
130 |
ggcttgacggttttgtttcatgttcggggtttattttgagtattttagactattattctatctttgtactgtattttgggtgttgtttgtttagtttttg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
10494654 |
ggcttgacggttttgtttcatgttcggggtttattttgagtattttagactattattctatc-ttgtactgtattttgggtgttgtttgtttagtttttg |
10494556 |
T |
 |
Q |
230 |
gattgtatcaagcatgcttatgtcgnnnnnnncgtnnnnnnnnttatcattttttctttcaactttatctcagttatctcactt |
313 |
Q |
|
|
||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10494555 |
gattgtatcaagcatgcttatgtcgtttttttcctaaaaaaatttatcattttttctttcaactttatctcagttatctcactt |
10494472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 10494401 - 10494358
Alignment:
Q |
385 |
aaacactacaaattccttcggttagtataactgctataaatttt |
428 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
T |
10494401 |
aaacactacaaattccttcggttagtataacacctataattttt |
10494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University