View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_20 (Length: 413)
Name: NF0962_high_20
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_high_20 |
 |  |
|
[»] scaffold0060 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 103 - 336
Target Start/End: Original strand, 8435018 - 8435249
Alignment:
Q |
103 |
aaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactgcacaattcggaaccattggcaactc |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
8435018 |
aaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactacacaattcggaaccattggcaacta |
8435117 |
T |
 |
Q |
203 |
atcaccatgaggaccactcagagatagagacactacagtttcttcgtttaattttcattgcagcgtcacatttttagatcatcgacaaatttaccattag |
302 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
8435118 |
atcaccatgaggaccactcagagatagagacattacagtttcttcgtttaattttcattgcagc--cacatttttagatcatcgacaaagttaccattag |
8435215 |
T |
 |
Q |
303 |
aattatataatattgctatcattttcggcctttg |
336 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
8435216 |
aattatataatattgctatcattttcggcctttg |
8435249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 75405 - 75367
Alignment:
Q |
103 |
aaataggcatttgcataaatcactaatgtgtagacaaaa |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
75405 |
aaataggcatttgcataaatcactaatgtgtagacaaaa |
75367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University