View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_24 (Length: 392)
Name: NF0962_high_24
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 132 - 382
Target Start/End: Complemental strand, 37791029 - 37790779
Alignment:
| Q |
132 |
cttattaaaccgacctttcttttctgaatgcccattgttgatgattgattaggaattgagtttcattatagannnnnnnngaagaataatgttagatatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37791029 |
cttattaaaccgacctttcttttctgaatgcccattgttgatgattgattaggaattgagtttcattatagattttttttgaagaataatgttagatatt |
37790930 |
T |
 |
| Q |
232 |
ttgctatattcaaacataactttgccagaatataatcatattttcactttatgtaaaccatgtaccattctttaggatatttcacagctgtcatgtttga |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790929 |
ttgctatattcaaacataactttgccagaatataatcatattttcactttatgtaaaccatgtaccattctttaggatatttcacagctgtcatgtttga |
37790830 |
T |
 |
| Q |
332 |
atttacactcgatgttctcgttactgttgcatcatacaccatttacctttg |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790829 |
atttacactcgatgttctcgttactgttgcatcatacaccatttacctttg |
37790779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University