View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_35 (Length: 360)
Name: NF0962_high_35
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 55 - 268
Target Start/End: Original strand, 49542656 - 49542867
Alignment:
Q |
55 |
gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgctaactggtaatttcaccttct |
154 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
49542656 |
gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgttttttactc--aattctctctgctaactggtaatttcaccttct |
49542753 |
T |
 |
Q |
155 |
tcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttcttgctattcaaggtttatctatgtactttgttttgacctttttca |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49542754 |
tcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttcttgcttttcaaggtttatctatgtactttgttttgacctttttca |
49542853 |
T |
 |
Q |
255 |
caacttgctgctat |
268 |
Q |
|
|
||| |||||||||| |
|
|
T |
49542854 |
caatttgctgctat |
49542867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 110 - 281
Target Start/End: Original strand, 47608047 - 47608215
Alignment:
Q |
110 |
ttttttactctcaattctctctgctaactggtaatttcaccttcttcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttc |
209 |
Q |
|
|
|||||| | ||||||||||| |||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| |||| |||||||||||| |
|
|
T |
47608047 |
tttttttcgctcaattctctatgctaaatggtaatttcaccttc---ttcttcttccgttgcacattaactatttgattcaacgaattaacacgttcttc |
47608143 |
T |
 |
Q |
210 |
ttgctattcaaggtttatctatgtactttgttttgacctttttcacaacttgctgctatagacttctctgct |
281 |
Q |
|
|
||||| |||||||||||||||||||||||||| | |||||||||||||| |||||||| ||| ||||||||| |
|
|
T |
47608144 |
ttgcttttcaaggtttatctatgtactttgttctcacctttttcacaacctgctgctacagatttctctgct |
47608215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49542559 - 49542615
Alignment:
Q |
1 |
actggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc |
57 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
49542559 |
actggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc |
49542615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 52894426 - 52894385
Alignment:
Q |
156 |
cttcttcttcggttgcacattaactgtttgattcaatgaatg |
197 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
52894426 |
cttcttcttcggttgcacataaactgtttgattaaatgaatg |
52894385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University