View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0962_high_39 (Length: 351)

Name: NF0962_high_39
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0962_high_39
NF0962_high_39
[»] chr7 (1 HSPs)
chr7 (43-270)||(1632332-1632560)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 43 - 270
Target Start/End: Complemental strand, 1632560 - 1632332
Alignment:
43 ggaccttgtgctcttccacttgaaaatccggagtggacacatcaattggccgttcctcctcctgtccggttgtggcaccagattgtgatagtaattgaat 142  Q
    ||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||    
1632560 ggaccgtgtgctcttccatttgaaactccggagtggacacatcaattggccgttcctcctcctatccggttggggcaccagattgtgatagtaattgaat 1632461  T
143 agcatcaggttgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcgaaagatttagatgaacctatgccgtcttgattatctttgggc 242  Q
    | |||||||  |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||    
1632460 aacatcaggccgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcaaaagctttagatgaacctatgccgtctggattatctttgggc 1632361  T
243 -tgccatttccgagtctgctgtttctgtg 270  Q
     ||||||||| || |||||||||||||||    
1632360 ttgccatttctgattctgctgtttctgtg 1632332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University