View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_41 (Length: 324)
Name: NF0962_high_41
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 12 - 217
Target Start/End: Original strand, 40695325 - 40695529
Alignment:
Q |
12 |
atcttgacattttggataaattaatgattgggccctgcatgaaagcatgaaattaagttgtaaaaagttatgtactagtaatcatattgcaatcaagacg |
111 |
Q |
|
|
||||||| ||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
40695325 |
atcttgattttttgcataaattaatgatcgggcccggcatgaaagcatgaaattaagttgtaaaaagt-atgtactagtaatcatattgcaatcaagacg |
40695423 |
T |
 |
Q |
112 |
accttgcaattgcatgatgttgacactaaaacatgcatcattttcaacctttctatggttaaagcgacatgcatcaaatgtggctgaaaattgacatttg |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40695424 |
accttgcaattgcatgatgttgacactaaaacatgcatcattttcaacctttctatggttaaagcgacatgcatcaaatgtggctgaaaattgacatttg |
40695523 |
T |
 |
Q |
212 |
caaact |
217 |
Q |
|
|
|||||| |
|
|
T |
40695524 |
caaact |
40695529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University