View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_43 (Length: 295)
Name: NF0962_high_43
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_high_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 235
Target Start/End: Original strand, 43620223 - 43620440
Alignment:
| Q |
21 |
gtaacagtcacgtcacattttttatgttgtggggaatcgcagtcaaatgtagttgataatcgatgtcactctggctgggagactgggacatcaaaacatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620223 |
gtaacagtcacgtcacattttttatgttgtggagaatcgcagtcaaatgtagttgataatcgatgtcactctggctgggagactgggacatcaaaacatg |
43620322 |
T |
 |
| Q |
121 |
gaccat---gatgttgaatatataatattgctttaattttttatgtatgtttaggttagctttactggttcaacacaaactgggcgtgagataatgcaag |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620323 |
gaccatattgatgttgaatatataatattgctttaattttttatgtatgtttaggttagctttactggttcaacacaaactgggcgtgagataatgcaag |
43620422 |
T |
 |
| Q |
218 |
ctgcagctaagagtaact |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43620423 |
ctgcagctaagagtaact |
43620440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University