View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_59 (Length: 237)
Name: NF0962_high_59
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_high_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 32219587 - 32219777
Alignment:
| Q |
1 |
ttttggctctttttatcatttcattggaggtgaatggagagagactaccactcagttgagggctctcttctctaaaacttgaattcagcattgcaagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32219587 |
ttttggctctttttatcatttcattggaggtgaatggagagagactaccactcagttgagggctctcttctctaaaacttgaattcagcattgcaagttc |
32219686 |
T |
 |
| Q |
101 |
tctaagttgttgcctcttgtaaatgtcttgcgactcatcctgcacaaaagaataataaaggagagttagaaatattttggcacaaggatga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32219687 |
tctaagttgttgcctcttgtaaatgtcttgtgactcatcctgcacaaaagaataataaaggagagttagaaatattttggcacaagaatga |
32219777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 28303992 - 28304122
Alignment:
| Q |
18 |
atttcattggaggtgaatggagagagactaccactcagttgagggctctcttctctaaaacttgaattcagcattgcaagttctctaagttgttgcctct |
117 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||| || | ||||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
28303992 |
atttcattggaagtgaatggagagacactgccactcagttgagggctctcttctctgaagttggaattgagcatagcaagttctcttagttgttgcctct |
28304091 |
T |
 |
| Q |
118 |
tgtaaatgtcttgcgactcatcctgcacaaa |
148 |
Q |
| |
|
|||||| ||| || |||||||||| |||||| |
|
|
| T |
28304092 |
tgtaaaggtcctgtgactcatcctacacaaa |
28304122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University