View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_61 (Length: 229)
Name: NF0962_high_61
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_high_61 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 36544716 - 36544945
Alignment:
| Q |
1 |
taaaattattaatacagtagatgcgaatcaccaattgaattgcaattagaggtagacataggctatttgtcataaattctggttttaatattttttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544716 |
taaaattattaatacagtagatgcgaatcaccaattgaattgcaattagaggtagacataggctatttgtcataaattctggttttaatattttttattt |
36544815 |
T |
 |
| Q |
101 |
gttccgacatttcaaatttcatatcgctaatgtcttttggttacactgcattttattttatttttgttac---atcgctaatgtggtaaggccaaaa-ag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||| || |
|
|
| T |
36544816 |
gttccgacatttcaaatttcatatcgctaatgtcttttggttacactgcattt--ttttctttttgttacaatatcgctaatgtggtaaggccaaaagag |
36544913 |
T |
 |
| Q |
197 |
taggttcttttagaagaaaacacatgaactatt |
229 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
36544914 |
taggttcttttagaag-aaacacatgaactatt |
36544945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University