View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_66 (Length: 218)
Name: NF0962_high_66
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_high_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 43083540 - 43083386
Alignment:
| Q |
14 |
cacagattggaccccataattgtatagattctttgaaatcgtagaaaaaacatgaaagatgataagaagtgtcctaagaacactagttacnnnnnnnnnn |
113 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
43083540 |
cacaaattggaccccacaattgtatagattctttgaaatcctagaaaaaatatgaatgatgataagaagtgtgctaagaacactagttacaaaaaaccaa |
43083441 |
T |
 |
| Q |
114 |
nnntatatagtatatatactaagttttattatcaattaacgtgactaatctctat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43083440 |
aaatatatagtatatatactaagttttattatcaattaacgtgactaatctctat |
43083386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University