View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0962_high_71 (Length: 205)

Name: NF0962_high_71
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0962_high_71
NF0962_high_71
[»] chr5 (1 HSPs)
chr5 (1-74)||(32219531-32219604)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 32219531 - 32219604
Alignment:
1 catgaagtaacttcaaatgcaacaatttcttaatgtagagaaagactattggtcagttttggctctttttatca 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32219531 catgaagtaacttcaaatgcaacaatttcttaatgtagagaaagactattggtcagttttggctctttttatca 32219604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University