View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0962_high_72 (Length: 203)

Name: NF0962_high_72
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0962_high_72
NF0962_high_72
[»] chr2 (2 HSPs)
chr2 (27-203)||(689572-689751)
chr2 (95-135)||(4543943-4543983)
[»] chr8 (1 HSPs)
chr8 (94-130)||(40582304-40582340)
[»] chr7 (1 HSPs)
chr7 (102-130)||(45032594-45032622)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 203
Target Start/End: Complemental strand, 689751 - 689572
Alignment:
27 gtaaggcaggggtatgcttcgtgattggaagtattgtcggcctcaccgtttgatgctaccactgttgggtttcggtgttccgtatatatgcggcaccttt 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
689751 gtaaggcaggggtatgcttcgtgattggaagtattgtcggcctcaccgtttgatgctaccactgttgggtttcggtgttccgtatatatacggcaccttt 689652  T
127 tgtaggt---ttgttaccgcgagattgtttgcttcttgcagcctctcgacgtgaataaaatttgttgttcctaaatgttc 203  Q
    |||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
689651 tgtaggtttcttgttaccgcgagattgtttgcttcttgcagcctctcgacgtgaataaaatttgttgttcctaaatgttc 689572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 95 - 135
Target Start/End: Complemental strand, 4543983 - 4543943
Alignment:
95 gtttcggtgttccgtatatatgcggcaccttttgtaggttt 135  Q
    |||| ||||||||||||||||||||||||||||||| ||||    
4543983 gttttggtgttccgtatatatgcggcaccttttgtatgttt 4543943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 130
Target Start/End: Complemental strand, 40582340 - 40582304
Alignment:
94 ggtttcggtgttccgtatatatgcggcaccttttgta 130  Q
    ||||| |||||||||||||||||||||||||| ||||    
40582340 ggttttggtgttccgtatatatgcggcaccttgtgta 40582304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 45032594 - 45032622
Alignment:
102 tgttccgtatatatgcggcaccttttgta 130  Q
    |||||||||||||||||||||||||||||    
45032594 tgttccgtatatatgcggcaccttttgta 45032622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University