View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_high_72 (Length: 203)
Name: NF0962_high_72
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_high_72 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 203
Target Start/End: Complemental strand, 689751 - 689572
Alignment:
Q |
27 |
gtaaggcaggggtatgcttcgtgattggaagtattgtcggcctcaccgtttgatgctaccactgttgggtttcggtgttccgtatatatgcggcaccttt |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
689751 |
gtaaggcaggggtatgcttcgtgattggaagtattgtcggcctcaccgtttgatgctaccactgttgggtttcggtgttccgtatatatacggcaccttt |
689652 |
T |
 |
Q |
127 |
tgtaggt---ttgttaccgcgagattgtttgcttcttgcagcctctcgacgtgaataaaatttgttgttcctaaatgttc |
203 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
689651 |
tgtaggtttcttgttaccgcgagattgtttgcttcttgcagcctctcgacgtgaataaaatttgttgttcctaaatgttc |
689572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 95 - 135
Target Start/End: Complemental strand, 4543983 - 4543943
Alignment:
Q |
95 |
gtttcggtgttccgtatatatgcggcaccttttgtaggttt |
135 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||| |||| |
|
|
T |
4543983 |
gttttggtgttccgtatatatgcggcaccttttgtatgttt |
4543943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 130
Target Start/End: Complemental strand, 40582340 - 40582304
Alignment:
Q |
94 |
ggtttcggtgttccgtatatatgcggcaccttttgta |
130 |
Q |
|
|
||||| |||||||||||||||||||||||||| |||| |
|
|
T |
40582340 |
ggttttggtgttccgtatatatgcggcaccttgtgta |
40582304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 45032594 - 45032622
Alignment:
Q |
102 |
tgttccgtatatatgcggcaccttttgta |
130 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
45032594 |
tgttccgtatatatgcggcaccttttgta |
45032622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University