View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_35 (Length: 383)
Name: NF0962_low_35
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 140 - 295
Target Start/End: Original strand, 5739238 - 5739393
Alignment:
| Q |
140 |
tgatgaattttggtgcaggtgtgtaatggggcattgttaagaaggaattatgtgactaaagatatcaactttggagttggggctcgtgctgccatgcttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5739238 |
tgatgaattttggtgcaggtgtgtaatggggcattgttaagaaggaattatgtgactaaagatatcaaatttggagttggggctcgtgctgccatgcttc |
5739337 |
T |
|
| Q |
240 |
aaggtgtttctgaggttgctgaggctgtcaaagttaccatgggacccaaggtattg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5739338 |
aaggtgtttctgaggttgctgaggctgtcaaagttaccatgggacccaaggtattg |
5739393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University