View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_39 (Length: 370)
Name: NF0962_low_39
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 30 - 362
Target Start/End: Original strand, 48214087 - 48214419
Alignment:
| Q |
30 |
gtctgaatgatttttcgatcgtcaagggtgaacatgaccgatctgtatgtatgttcattcaacctgaatctatgtaatttcattatctcatgttttatac |
129 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48214087 |
gtctgaatgatttttcgatcatcaagggtgaacatgaccaatctgtatgtatgttcattcaacctgaatcattgtaatttcattatctcatgttttatac |
48214186 |
T |
|
| Q |
130 |
tcatatttcaaaaccttgtgtgtttatgcatgtttgatctatctatgtttacgctttatgggcaaacgcatgtgttctcaccatttaatactaaaaaagg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48214187 |
tcatatttcaaaaccttgtgtgtttatgcatgttcgatctatctatgtttacgctttatgggcaaacgcatgtgttctcaccatttaattctaaaaaagg |
48214286 |
T |
|
| Q |
230 |
tttgtaatcttatacgtttatgttgattttgtgtttgagatctttatatgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcct |
329 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48214287 |
tttgtaatcttatacgtttatggtgattttgtgtttgagatctttatgtgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcct |
48214386 |
T |
|
| Q |
330 |
aaccttcgatcagctcggtttgtaacctatgat |
362 |
Q |
| |
|
| ||||||||||||||||||||||||| |||| |
|
|
| T |
48214387 |
gatcttcgatcagctcggtttgtaacctttgat |
48214419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University