View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_48 (Length: 351)
Name: NF0962_low_48
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 43 - 270
Target Start/End: Complemental strand, 1632560 - 1632332
Alignment:
| Q |
43 |
ggaccttgtgctcttccacttgaaaatccggagtggacacatcaattggccgttcctcctcctgtccggttgtggcaccagattgtgatagtaattgaat |
142 |
Q |
| |
|
||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1632560 |
ggaccgtgtgctcttccatttgaaactccggagtggacacatcaattggccgttcctcctcctatccggttggggcaccagattgtgatagtaattgaat |
1632461 |
T |
 |
| Q |
143 |
agcatcaggttgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcgaaagatttagatgaacctatgccgtcttgattatctttgggc |
242 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1632460 |
aacatcaggccgcggtattgtattgtcagctgcaacgtcattgatcaccggagcttcaaaagctttagatgaacctatgccgtctggattatctttgggc |
1632361 |
T |
 |
| Q |
243 |
-tgccatttccgagtctgctgtttctgtg |
270 |
Q |
| |
|
||||||||| || ||||||||||||||| |
|
|
| T |
1632360 |
ttgccatttctgattctgctgtttctgtg |
1632332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University