View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_53 (Length: 321)
Name: NF0962_low_53
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 85 - 214
Target Start/End: Complemental strand, 36886672 - 36886543
Alignment:
| Q |
85 |
atgaaattgaatatttaaggactgagttatatacaacatgcaagtatatttctaaggatcagaataccagttgattaattatgttcatattgattttaga |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36886672 |
atgaaattgaatatttaaggactgagttatatacaacatgcaagtatatttctaaggatcagaataccagttgattagttatgttcatattgattttaga |
36886573 |
T |
|
| Q |
185 |
ccaatctcaatagagatgataataatacag |
214 |
Q |
| |
|
|||| || |||||| ||||||||||||||| |
|
|
| T |
36886572 |
ccaagcttaatagacatgataataatacag |
36886543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University