View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_61 (Length: 284)
Name: NF0962_low_61
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0962_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 29 - 271
Target Start/End: Original strand, 47183770 - 47184012
Alignment:
Q |
29 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatttatattgcctta |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
T |
47183770 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttggttatgatattggtatttcaggtacatttatatagcctta |
47183869 |
T |
 |
Q |
129 |
ttctaaaggtttttgttctgattttgtatttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
228 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47183870 |
ttctaaaggtttttgttctgattttgtacttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
47183969 |
T |
 |
Q |
229 |
tatcttatgaccaaaactccataatacctaaaaccatttacct |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47183970 |
tatcttatgaccaaaactccataatacctaaaaccatttacct |
47184012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 52 - 116
Target Start/End: Original strand, 47196681 - 47196745
Alignment:
Q |
52 |
tcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatt |
116 |
Q |
|
|
|||||||| ||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
T |
47196681 |
tcttgcatcatggctgctactggtggtcttatgtttggttatgatgttggtatttcaggtacatt |
47196745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 111
Target Start/End: Complemental strand, 751544 - 751491
Alignment:
Q |
58 |
attatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggt |
111 |
Q |
|
|
|||||||||||| ||||||||||||||| || |||||| ||||| |||||||| |
|
|
T |
751544 |
attatggctgctaccggtggtcttatgttcggttatgatgttggtgtttcaggt |
751491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University