View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_66 (Length: 269)
Name: NF0962_low_66
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 6625958 - 6626182
Alignment:
| Q |
13 |
aatatgtctgcttccttcattgcacacaatgctccagtttctctgcaaggaatgaaaatatgtttcagggatgccagatgagaaagagaaaagtgaatag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6625958 |
aatatgtctgcttccttcattgcacacaatgctccagtttctctgcaaggaatgaaaatatgtttcagagatgccagatgagaaagagaaaagtgaatag |
6626057 |
T |
|
| Q |
113 |
ctcaaactggttgcctaactttggtacacatacctattagtggcaacataaacacttccaaaagtacctcgccctataagtttacccttttgccattgac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626058 |
ctcaaactggttgcctaactttggtacacatacctattagtggcaacataaacacttccaaaagtacctcgccctataagtttacccttttgccattgac |
6626157 |
T |
|
| Q |
213 |
ttttcatagataaggactctgtctt |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6626158 |
ttttcatagataaggactctgtctt |
6626182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University