View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_67 (Length: 268)
Name: NF0962_low_67
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 68 - 224
Target Start/End: Original strand, 49321099 - 49321257
Alignment:
| Q |
68 |
ttctcactataaggtaaaaagaatattgtaggagtacatcgataaacttacagacattgccatttgtttttcattgcagaaaatgttc--tatatattat |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49321099 |
ttctgactataaggtaaaaagaatattgtaggagtacatcgataaacttacagacattgccatttgtttttcattgcagaaaatgttctatatatattat |
49321198 |
T |
 |
| Q |
166 |
ctgagaagcaaagagtattaatgtgcattttattgatgctaaaatttatgcaatttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49321199 |
ctgagaagcaaagagtattaatgtgcattttattgatgctaaaatttatgcaatttttt |
49321257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University