View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0962_low_75 (Length: 244)
Name: NF0962_low_75
Description: NF0962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0962_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26994948 - 26994727
Alignment:
| Q |
1 |
ttccctgcaagcatgtaatgcagtgcatatatctgtcttctccaggaatttctctgcattttcaaataccaagggaccatactctagaacaatcttcttg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26994948 |
ttccttgcaagcatgtaatgcagtgcatatatctgtcttctccaggaatttctctgcattttcaaataccaagggaccatactctagaacaatcttcttg |
26994849 |
T |
 |
| Q |
101 |
cactgcaaacattttgggagagtaacgnnnnnnnccaaatcagtcgatgagaaaaaaggttgattaggaaaattacatttacaaaatttcatacgagtcg |
200 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26994848 |
cactgcaaacatttcgggagagtaacgaaaaaaaccaaatcagtcgatgagaaaaaaggttgattaggaaaattacatttacaaaatttcatacgagtcg |
26994749 |
T |
 |
| Q |
201 |
atacaattgacaaccatttttc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26994748 |
atacaattgacaaccatttttc |
26994727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University