View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_high_6 (Length: 255)
Name: NF0963_high_6
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 13 - 164
Target Start/End: Complemental strand, 52344215 - 52344064
Alignment:
| Q |
13 |
gagatgaacgcatttccaaatgcaaattcgctaagaggttttgagttaatagatgacatcaaatctcaattggaggatatgtgtcccaataccgtctctt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52344215 |
gagaagaacgcatttccaaatgcaaattcgctaagaggttttgagttaatagatgacatcaaatctcaattggaggatatgtgtcccaatactgtctctt |
52344116 |
T |
|
| Q |
113 |
gttctgacatcttagcccttgctgctagggacggtgttgctgaggtaaatat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344115 |
gttctgacatcttagcccttgctgctagggacggtgttgctgaggtaaatat |
52344064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 9155609 - 9155500
Alignment:
| Q |
34 |
gcaaattcgctaagaggttttgagttaatagatgacatcaaatctcaattggaggatatgtgtcccaataccgtctcttgttctgacatcttagcccttg |
133 |
Q |
| |
|
||||| ||||||||||||||||||||||| || |||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||| || ||| |
|
|
| T |
9155609 |
gcaaactcgctaagaggttttgagttaattgacgacatcaaatctacattggagacaatgtgtcctaatgttgtctcttgtgctgacatcttaaccgttg |
9155510 |
T |
|
| Q |
134 |
ctgctaggga |
143 |
Q |
| |
|
|||||||||| |
|
|
| T |
9155509 |
ctgctaggga |
9155500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University