View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_high_9 (Length: 247)
Name: NF0963_high_9
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 51 - 206
Target Start/End: Original strand, 515783 - 515938
Alignment:
| Q |
51 |
ctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatcttggtcctttaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515783 |
ctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatcttggtcctttaa |
515882 |
T |
 |
| Q |
151 |
tgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515883 |
tgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgt |
515938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 515797 - 515757
Alignment:
| Q |
1 |
cattacaattttcagctgacggagggagagccacaggttct |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
515797 |
cattacaattttcagctgacggagggagagcctcaggttct |
515757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University