View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_10 (Length: 296)
Name: NF0963_low_10
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 81 - 243
Target Start/End: Complemental strand, 4626980 - 4626818
Alignment:
| Q |
81 |
tgtatactactacttactttggtagggcttagattgaataacaactctcttaacaacgatttgtctagatcaaaagcggtgggagggtgatcatttccat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626980 |
tgtatactactacttactttggtagggcttagattgaataacaactctcttaacaatgatttgtctagatcaaaagcggtgggagggtgatcatttccat |
4626881 |
T |
|
| Q |
181 |
tcgcatacaaaaacttctgagcctgtggcatgagatcatttgatcctgcctgcaacagctagg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4626880 |
tcgcatacaaaaacttctgagcctgtggcatgagatcatttgatcctgcctgcaacagatagg |
4626818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University