View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_14 (Length: 251)
Name: NF0963_low_14
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 53292973 - 53293120
Alignment:
| Q |
1 |
agaaaactaacatttccgccttttctgctaacaattattaacacttagcatctatctttaagat--nnnnnnnnnntagagttttgctattaacattatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53292973 |
agaaaactaacatttccgccttttctgctaacaattattaacacttagcatctatctttaagataaaaaaaaaaaatagagttttgctattaacattatt |
53293072 |
T |
|
| Q |
99 |
tctctttaaaaggagtgatttttgatccgaaatcattgctccaaattg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53293073 |
tctctttaaaaggagtgatttttgatccgaaatcatcactccaaattg |
53293120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University