View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_15 (Length: 248)
Name: NF0963_low_15
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 27 - 248
Target Start/End: Complemental strand, 48248584 - 48248366
Alignment:
| Q |
27 |
gcatcttaccggttgagacggaaacagagacggtctcgttgacggttgtggattggttttccgatgaagatttgcggtggctggctttgtgaccaccaag |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48248584 |
gcatcttactggttgagacggaaacagagatggtctcgttgacggttgtggattggttttccgatgaagatttgcggtggctggctttgtgaccaccaag |
48248485 |
T |
 |
| Q |
127 |
tgcttgataagatggaaaagctttgttacaaacactgcacttgtgattgagctgcttcaacggtgatgattcaatttgtctgttgctttgtgagagcatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
48248484 |
tgcttgataagatggaaaagctttgttgcaaacactgcacttgtgattga---gcttcaacggtgatgattgaatttggttgttgctttgtgagagcatg |
48248388 |
T |
 |
| Q |
227 |
atgagacagagagcaagatatt |
248 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48248387 |
atgagacagagagcaagatatt |
48248366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 153
Target Start/End: Original strand, 47436028 - 47436080
Alignment:
| Q |
101 |
cggtggctggctttgtgaccaccaagtgcttgataagatggaaaagctttgtt |
153 |
Q |
| |
|
||||| ||||||||||| ||||| || ||||||||||||| |||||||||||| |
|
|
| T |
47436028 |
cggtgactggctttgtgtccacctagggcttgataagatgaaaaagctttgtt |
47436080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University