View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0963_low_15 (Length: 248)

Name: NF0963_low_15
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0963_low_15
NF0963_low_15
[»] chr1 (1 HSPs)
chr1 (27-248)||(48248366-48248584)
[»] chr3 (1 HSPs)
chr3 (101-153)||(47436028-47436080)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 27 - 248
Target Start/End: Complemental strand, 48248584 - 48248366
Alignment:
27 gcatcttaccggttgagacggaaacagagacggtctcgttgacggttgtggattggttttccgatgaagatttgcggtggctggctttgtgaccaccaag 126  Q
    ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48248584 gcatcttactggttgagacggaaacagagatggtctcgttgacggttgtggattggttttccgatgaagatttgcggtggctggctttgtgaccaccaag 48248485  T
127 tgcttgataagatggaaaagctttgttacaaacactgcacttgtgattgagctgcttcaacggtgatgattcaatttgtctgttgctttgtgagagcatg 226  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||   |||||||||||||||||| ||||||  ||||||||||||||||||||    
48248484 tgcttgataagatggaaaagctttgttgcaaacactgcacttgtgattga---gcttcaacggtgatgattgaatttggttgttgctttgtgagagcatg 48248388  T
227 atgagacagagagcaagatatt 248  Q
    ||||||||||||||||||||||    
48248387 atgagacagagagcaagatatt 48248366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 153
Target Start/End: Original strand, 47436028 - 47436080
Alignment:
101 cggtggctggctttgtgaccaccaagtgcttgataagatggaaaagctttgtt 153  Q
    ||||| ||||||||||| ||||| || ||||||||||||| ||||||||||||    
47436028 cggtgactggctttgtgtccacctagggcttgataagatgaaaaagctttgtt 47436080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University