View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_17 (Length: 238)
Name: NF0963_low_17
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 228
Target Start/End: Complemental strand, 44743018 - 44742793
Alignment:
| Q |
2 |
ctctctcgctctgaaccataaaataaaacacttcttcatcatcaaaaccacctagttacattctcactccgatcccgccacttcacggccacaaattcag |
101 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44743018 |
ctctctcgctctgaaccctaaaattaaacacttcttcatcatccaaaccacctagtttcattctcactccgatcccgccacttcacggccgcaaattcag |
44742919 |
T |
 |
| Q |
102 |
cactttctcacttttccagctcttcaaggaggtttgtcgatccaactttttaatactttttgatgttttagtaaaagcaaacagtataaaattaatttgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44742918 |
cactttctcacttttccagctcttcaaggaggtttgtcgatccaac-ttttaatactttttgatgttttagtaaaagcaaagagtataaaattaatttgc |
44742820 |
T |
 |
| Q |
202 |
aggtatctataacatctatgttctgtg |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44742819 |
aggtatctataacatctatgttctgtg |
44742793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 53238802 - 53238684
Alignment:
| Q |
51 |
acctagttacattctcactccgatcccgccacttcacggccacaaattcagcactttctcacttttccagctcttcaaggaggtttgtcgatccaacttt |
150 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |||||||| || ||||| ||||||||||||||| |||||||| ||||||| ||| || |
|
|
| T |
53238802 |
acctagtttcattctcgctccgatcccgccacttcacggccgcaaattcaacaatttcttacttttccagctctttaaggaggtaagtcgatctaac-tt |
53238704 |
T |
 |
| Q |
151 |
ttaatactttttgatgtttt |
170 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53238703 |
ttaatactttttgatgtttt |
53238684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University