View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_7 (Length: 322)
Name: NF0963_low_7
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0963_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 180 - 293
Target Start/End: Complemental strand, 8019513 - 8019400
Alignment:
Q |
180 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacaattgtatgattttaggctgatatcactggtctggtatatgcacaaagtgttg |
279 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
T |
8019513 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacgattgtatgattttaggctaatatcactagtctggcatatgcacaaagtgttg |
8019414 |
T |
 |
Q |
280 |
tcgaaacttgtagc |
293 |
Q |
|
|
|||||| ||||||| |
|
|
T |
8019413 |
tcgaaagttgtagc |
8019400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 12 - 68
Target Start/End: Complemental strand, 8019584 - 8019528
Alignment:
Q |
12 |
gaataaccaagtacaatagggatggtaaaaggttgttgagatatttgatatactaga |
68 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
8019584 |
gaataaccaagtacaatagagatggtaaaaggttgttgagatatttgatatactaga |
8019528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 37 - 97
Target Start/End: Original strand, 17746778 - 17746838
Alignment:
Q |
37 |
taaaaggttgttgagatatttgatatactagagtgtttattcaaactcacaagttctctct |
97 |
Q |
|
|
||||||||||| ||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
T |
17746778 |
taaaaggttgtgaagatatttgatatacgagagtgttgattcaaactcacagtttctctct |
17746838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 37 - 97
Target Start/End: Original strand, 19048098 - 19048158
Alignment:
Q |
37 |
taaaaggttgttgagatatttgatatactagagtgtttattcaaactcacaagttctctct |
97 |
Q |
|
|
||||||||||| ||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
T |
19048098 |
taaaaggttgtgaagatatttgatatacgagagtgttgattcaaactcacagtttctctct |
19048158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 39 - 86
Target Start/End: Complemental strand, 28001919 - 28001872
Alignment:
Q |
39 |
aaaggttgttgagatatttgatatactagagtgtttattcaaactcac |
86 |
Q |
|
|
||||||||| ||||||||| |||||||||||||| |||||||||||| |
|
|
T |
28001919 |
aaaggttgtggagatatttaatatactagagtgtcgattcaaactcac |
28001872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 12217255 - 12217309
Alignment:
Q |
132 |
aacttgttccacaaactatccaggtagttagttttaactaactgtaataggtttta |
187 |
Q |
|
|
|||||||||||||| |||| || ||||||||| |||||||||||||||||||||| |
|
|
T |
12217255 |
aacttgttccacaagttatctag-tagttagttgtaactaactgtaataggtttta |
12217309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University