View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0963_low_9 (Length: 313)
Name: NF0963_low_9
Description: NF0963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0963_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 159 - 284
Target Start/End: Complemental strand, 39241582 - 39241457
Alignment:
| Q |
159 |
tgaattgatttgtatcaatttatttatgattgtgtgagacaggatgagaattggagcaaatgggttttatgcaaagtttatgaaaaggaaaagaagatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39241582 |
tgaattgatttgtatcaatttatttatgattgtgtgagacaggatgagaattggagcaaatgggttttatgcaaagtttatgaaaaggaaaagaagatgt |
39241483 |
T |
|
| Q |
259 |
cacaagaaggtgcaagctgttgttat |
284 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39241482 |
cacaagaaggtgcaagctgttgttat |
39241457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 39241727 - 39241637
Alignment:
| Q |
9 |
gaagaatatcatatttcctcatctccggtaagtgattgtgttttgttttgttgactacctatttatacatcacaacaaattacttattaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39241727 |
gaagaatatcatatttcctcatctccggtaagtgattgtgttttgttttgttgactacctatttataaatcacaacaaattacttattaag |
39241637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University