View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_high_33 (Length: 218)
Name: NF0964_high_33
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 35808593 - 35808386
Alignment:
| Q |
1 |
tcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataatttaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808593 |
tcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataatttaagt |
35808494 |
T |
|
| Q |
101 |
cacagttcttcatctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctgttatcaccccctttccctta |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808493 |
cacagttcttcgtctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctgttatcaccccctttccctta |
35808394 |
T |
|
| Q |
201 |
ttttgttg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
35808393 |
ttttgttg |
35808386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University