View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_high_37 (Length: 209)
Name: NF0964_high_37
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 3982918 - 3982829
Alignment:
| Q |
1 |
ataaccggagcgtcgaatattttgggaaaacattaaattttgtagcattagtagcaaatttcattgagttcgcttcacagtagaatgatt |
90 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982918 |
ataaccggagtgtcgaatattttgggaaaacattaaattttgtaccattagtagcaaatttcattgagttcgcttcacagtagaatgatt |
3982829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University