View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_26 (Length: 357)
Name: NF0964_low_26
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 41 - 321
Target Start/End: Complemental strand, 10576370 - 10576089
Alignment:
| Q |
41 |
tgttattcctttggtgctttcattttgtcataagaggttgaacattggtggnnnnnnn-ctcgccggaatatggaagcagaggctgtagaagtggaagtc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576370 |
tgttattcctttggtgctttcattttgtcagaagaggttgaacattggtggaaaaaaaactcgccggaatatggaagcagaggctgtagaagtggaagtc |
10576271 |
T |
|
| Q |
140 |
tttgaactgaagcaagggaatacgttcgtagctgacaatgcagtcaaatttgagaaatagtctatgttctgtcccactataatggtgcatatgcaattca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10576270 |
tttgaactgaagcaagggaatacgttcgtagctgacaatgcagtcaaatttgagaaatagtctatgttctgtcccactataatggtgtatatgcaattca |
10576171 |
T |
|
| Q |
240 |
ttggccaccaggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaacagcta |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10576170 |
ttggccaccaggagatgctaatgtttttctatccttgtgaataaatgcaaaatttatgatgaagatagcatggcaagagcta |
10576089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University