View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_37 (Length: 324)
Name: NF0964_low_37
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 32 - 226
Target Start/End: Original strand, 29679311 - 29679506
Alignment:
| Q |
32 |
aatattttggtagttcataacctgaaaaacaacttattctcagcaaatcaacttaataatggttttatttttgaatttaagttggattgttttgttatta |
131 |
Q |
| |
|
|||||||||||| | |||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
29679311 |
aatattttggtaatccataaccttaaaaagaacttattctcagcaaatcaacttaataatgattttatttttgaatttaactcggattgttttgttatta |
29679410 |
T |
|
| Q |
132 |
aagattgaaatcaaaggattttaaacgaaggacataaa-aaggcaaactctatgcactgacggggaaacttttgaagctctctctactattaaaga |
226 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29679411 |
aggatagaaatcaaaggattttaaacgaaggacataaacaaggcaaactctatgcattgacggggaaacttttgaagctctctctactattaaaga |
29679506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University