View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_38 (Length: 322)
Name: NF0964_low_38
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 84 - 120
Target Start/End: Complemental strand, 32091641 - 32091605
Alignment:
| Q |
84 |
atgaaatggttaacctgtgcagactcagatgcaattc |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32091641 |
atgaaatggttaacctgtgtagactcagatgcaattc |
32091605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 32089944 - 32089909
Alignment:
| Q |
186 |
cccattgggagcctatgacagttgaagctgtgcttg |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32089944 |
cccattaggagcctatgacagttgaagctgtgcttg |
32089909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University