View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0964_low_39 (Length: 314)

Name: NF0964_low_39
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0964_low_39
NF0964_low_39
[»] chr3 (1 HSPs)
chr3 (105-236)||(23914889-23915020)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 105 - 236
Target Start/End: Original strand, 23914889 - 23915020
Alignment:
105 aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggccaatggtagtttagataagtttcttcata 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
23914889 aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggttaatggtagtttagataagtttcttcata 23914988  T
205 gagaattatctcatgagtgtgatattttgttg 236  Q
    ||||||||||||||||||||||||||||||||    
23914989 gagaattatctcatgagtgtgatattttgttg 23915020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University