View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_48 (Length: 276)
Name: NF0964_low_48
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 55242933 - 55243070
Alignment:
| Q |
26 |
caggtaggagtgttaaagtgtaatgttgatgcgatcaacttgacgatctcatatgaattccacgacatatggtttgaatcggacaacaaaaccctctctc |
125 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55242933 |
caggtaggtgtgttaaagtgtaatgttgatgcgatcaacttggcgatctcatatgaattccacgacatatggtttgaatcggacaacaaaaccctctctc |
55243032 |
T |
 |
| Q |
126 |
atgccattacctctacatatatccatcacaacgagttt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55243033 |
atgccattacctctacatatatccatcacaacgagttt |
55243070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University