View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_50 (Length: 253)
Name: NF0964_low_50
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 32 - 249
Target Start/End: Complemental strand, 34190504 - 34190278
Alignment:
| Q |
32 |
agacaaacgcagagggataggtttgcctgtgagacgctggagtgcattggagtcgagatggaaaccatcagcagagctggtggtttcaggtgatgatgaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34190504 |
agacaaacgcagagggataggtttgcctgtgagacgctggagtgcattggagtcgagatggaaaccatcagcagagctagtggtttcaggtgatgatgaa |
34190405 |
T |
 |
| Q |
132 |
ga---------gagtggaagaagtgtggtttgagaagggaaatttggtatatgaatggtgcaaaaacatggtattgttgttgttgaaggatgaatacgtg |
222 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190404 |
gatgatgaagagagtggaagaagtgtggtttgagaagggaaatttggtatatgaatggtgcaaaaacatggtattgttgttgttgaaggatgaatacgtg |
34190305 |
T |
 |
| Q |
223 |
aaagtggtgatgatattgttggagatg |
249 |
Q |
| |
|
|||||||||||| | ||||||| |||| |
|
|
| T |
34190304 |
aaagtggtgatggttttgttggtgatg |
34190278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University