View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_54 (Length: 237)
Name: NF0964_low_54
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 45073422 - 45073488
Alignment:
| Q |
73 |
agattattcttcaacctcaagaaatggcagtagcccacttgacagcaatggaaataaacctgcatag |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073422 |
agataattcttcaacctcaagaaatggcagtagcccacttgacagcaatggaaataaacctgcatag |
45073488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 8880281 - 8880347
Alignment:
| Q |
73 |
agattattcttcaacctcaagaaatggcagtagcccacttgacagcaatggaaataaacctgcatag |
139 |
Q |
| |
|
|||| ||||||||||||| || |||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8880281 |
agataattcttcaacctcgagtaatggcagtagcccgcttgacaacaatggaaataaacctgcatag |
8880347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University