View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_55 (Length: 236)
Name: NF0964_low_55
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 21194331 - 21194162
Alignment:
| Q |
1 |
ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattggtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21194331 |
ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattgatgc |
21194232 |
T |
|
| Q |
101 |
tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcatat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21194231 |
tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcatat |
21194162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 170
Target Start/End: Original strand, 8496882 - 8496992
Alignment:
| Q |
60 |
ccatctacacttgtcattggtcctgaaagtagcattggtgctgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgtt |
159 |
Q |
| |
|
|||||| |||||| ||||| |||||| |||| ||| |||||||| || ||||||||||||||||| | |||| ||||||||| | |||||||||| |
|
|
| T |
8496882 |
ccatctgcacttgacattgatcctgatagtaacatgcttgctgctgctgaagttgttgatgccattgccatagctgctggtggtagtggatggttatgtg |
8496981 |
T |
|
| Q |
160 |
gtccttcatat |
170 |
Q |
| |
|
|||||||||| |
|
|
| T |
8496982 |
ttccttcatat |
8496992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University